Antibodies
Anti-SPAK Antibody-Oligo Conjugate
SKU: aoc3491
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SPAK Antibody-IF1
Antibody Target
- Target
- STE20/SPS1-related proline-alanine-rich protein kinase
- UniProt Number
- Q9UEW8
- Target Description
- Effector serine/threonine-protein kinase component of the WNK-SPAK/OSR1 kinase cascade, which is involved in various processes, such as ion transport, response to hypertonic stress and blood pressure. Specifically recognizes and binds proteins with a RFXV motif. Acts downstream of WNK kinases (WNK1, WNK2, WNK3 or WNK4): following activation by WNK kinases, catalyzes phosphorylation of ion cotransporters, such as SLC12A1/NKCC2, SLC12A2/NKCC1, SLC12A3/NCC, SLC12A5/KCC2 or SLC12A6/KCC3, regulating their activity. Mediates regulatory volume increase in response to hyperosmotic stress by catalyzing phosphorylation of ion cotransporters SLC12A1/NKCC2, SLC12A2/NKCC1 and SLC12A6/KCC3 downstream of WNK1 and WNK3 kinases. Phosphorylation of Na-K-Cl cotransporters SLC12A2/NKCC1 and SLC12A2/NKCC1 promote their activation and ion influx; simultaneously, phosphorylation of K-Cl cotransporters SLC12A5/KCC2 and SLC12A6/KCC3 inhibit their activity, blocking ion efflux. Acts as a regulator of NaCl reabsorption in the distal nephron by mediating phosphorylation and activation of the thiazide-sensitive Na-Cl cotransporter SLC12A3/NCC in distal convoluted tubule cells of kidney downstream of WNK4. Mediates the inhibition of SLC4A4, SLC26A6 as well as CFTR activities. Phosphorylates RELT.
- Molecular Weight
- 59kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC1896
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat