Antibodies
Anti-SPAM1 Antibody-Oligo Conjugate
SKU: aoc3492
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SPAM1 Antibody-IF1
Antibody Target
- Target
- Hyaluronidase PH-20
- UniProt Number
- P38567
- Target Description
- Involved in sperm-egg adhesion. Upon fertilization sperm must first penetrate a layer of cumulus cells that surrounds the egg before reaching the zona pellucida. The cumulus cells are embedded in a matrix containing hyaluronic acid which is formed prior to ovulation. This protein aids in penetrating the layer of cumulus cells by digesting hyaluronic acid.
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC56311
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Rat