Antibodies
Anti-SPRY2 Antibody-Oligo Conjugate
SKU: aoc3497
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SPRY2 Antibody-IF1
Antibody Target
- Target
- Protein sprouty homolog 2
- UniProt Number
- O43597
- Target Description
- Antagonist of fibroblast growth factor (FGF) pathways via inhibition of FGF-mediated phosphorylation of ERK1/2. Thereby acts as an antagonist of FGF-induced retinal lens fiber differentiation, may inhibit limb bud outgrowth and may negatively modulate respiratory organogenesis. Inhibits TGFB-induced epithelial-to-mesenchymal transition in retinal lens epithelial cells. Inhibits CBL/C-CBL-mediated EGFR ubiquitination.
- Molecular Weight
- 35kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1753
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat