Antibodies
Anti-SPT5 Antibody-Oligo Conjugate
SKU: aoc3498
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SPT5 Antibody-IF1
Antibody Target
- Target
- Transcription elongation factor SPT5
- UniProt Number
- O00267
- Target Description
- Component of the DRB sensitivity-inducing factor complex (DSIF complex), which regulates mRNA processing and transcription elongation by RNA polymerase II. DSIF positively regulates mRNA capping by stimulating the mRNA guanylyltransferase activity of RNGTT/CAP1A. DSIF also acts cooperatively with the negative elongation factor complex (NELF complex) to enhance transcriptional pausing at sites proximal to the promoter. Transcriptional pausing may facilitate the assembly of an elongation competent RNA polymerase II complex. DSIF and NELF promote pausing by inhibition of the transcription elongation factor TFIIS/S-II. TFIIS/S-II binds to RNA polymerase II at transcription pause sites and stimulates the weak intrinsic nuclease activity of the enzyme. Cleavage of blocked transcripts by RNA polymerase II promotes the resumption of transcription from the new 3' terminus and may allow repeated attempts at transcription through natural pause sites. Following phosphorylation by CDK9, DSIF can also positively regulate transcriptional elongation. Required for the efficient activation of transcriptional elongation by the HIV-1 nuclear transcriptional activator, Tat. DSIF acts to suppress transcriptional pausing in transcripts derived from the HIV-1 LTR and blocks premature release of HIV-1 transcripts at terminator sequences.
- Molecular Weight
- 121kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC2380
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat