Antibodies
Anti-SR-BI Antibody-Oligo Conjugate
SKU: aoc3501
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SR-BI Antibody-IF1
Antibody Target
- Target
- Scavenger receptor class B member 1
- UniProt Number
- Q8WTV0
- Target Description
- Receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells. Receptor for HDL, mediating selective uptake of cholesteryl ether and HDL-dependent cholesterol efflux. Also facilitates the flux of free and esterified cholesterol between the cell surface and apoB-containing lipoproteins and modified lipoproteins, although less efficiently than HDL. May be involved in the phagocytosis of apoptotic cells, via its phosphatidylserine binding activity.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus in hepatocytes and appears to facilitate its cell entry. Binding between SCARB1 and the hepatitis C virus glycoprotein E2 is independent of the genotype of the viral isolate.; FUNCTION: (Microbial infection) Mediates uptake of M.fortuitum, E.coli and S.aureus.; FUNCTION: (Microbial infection) Facilitates the entry of human coronavirus SARS-CoV-2 by acting as an entry cofactor through HDL binding.
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0334
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat