Antibodies
Anti-SR protein repeat Antibody-Oligo Conjugate
SKU: aoc3499
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SR protein repeat Antibody-IF1
Antibody Target
- Target
- Serine/arginine-rich splicing factor 6
- UniProt Number
- Q13247
- Target Description
- Plays a role in constitutive splicing and modulates the selection of alternative splice sites. Plays a role in the alternative splicing of MAPT/Tau exon 10. Binds to alternative exons of TNC pre-mRNA and promotes the expression of alternatively spliced TNC. Plays a role in wound healing and in the regulation of keratinocyte differentiation and proliferation via its role in alternative splicing.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC2754
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat