Antibodies
Anti-SRP54 Antibody-Oligo Conjugate
SKU: aoc3504
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SRP54 Antibody-IF1
Antibody Target
- Target
- Signal recognition particle subunit SRP54
- UniProt Number
- P61011
- Target Description
- Component of the signal recognition particle (SRP) complex, a ribonucleoprotein complex that mediates the cotranslational targeting of secretory and membrane proteins to the endoplasmic reticulum (ER). As part of the SRP complex, associates with the SRP receptor (SR) component SRPRA to target secretory proteins to the endoplasmic reticulum membrane. Binds to the signal sequence of presecretory proteins when they emerge from the ribosomes. Displays basal GTPase activity, and stimulates reciprocal GTPase activation of the SR subunit SRPRA. Forms a guanosine 5'-triphosphate (GTP)-dependent complex with the SR subunit SRPRA. SR compaction and GTPase mediated rearrangement of SR drive SRP-mediated cotranslational protein translocation into the ER. Requires the presence of SRP9/SRP14 and/or SRP19 to stably interact with RNA. Plays a role in proliferation and differentiation of granulocytic cells, neutrophils migration capacity and exocrine pancreas development.
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1904
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat