Antibodies
Anti-SRP72 Antibody-Oligo Conjugate
SKU: aoc3505
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SRP72 Antibody-IF1
Antibody Target
- Target
- Signal recognition particle subunit SRP72
- UniProt Number
- O76094
- Target Description
- Component of the signal recognition particle (SRP) complex, a ribonucleoprotein complex that mediates the cotranslational targeting of secretory and membrane proteins to the endoplasmic reticulum (ER). The SRP complex interacts with the signal sequence in nascent secretory and membrane proteins and directs them to the membrane of the ER. The SRP complex targets the ribosome-nascent chain complex to the SRP receptor (SR), which is anchored in the ER, where SR compaction and GTPase rearrangement drive cotranslational protein translocation into the ER. Binds the signal recognition particle RNA (7SL RNA) in presence of SRP68. Can bind 7SL RNA with low affinity. The SRP complex possibly participates in the elongation arrest function.
- Molecular Weight
- 75kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC63042
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat