Antibodies

Anti-SRPK1 Antibody-Oligo Conjugate

SKU: aoc3506

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-SRPK1 Antibody-IF1

Antibody Target

Target
SRSF protein kinase 1
UniProt Number
Q96SB4
Target Description
Serine/arginine-rich protein-specific kinase which specifically phosphorylates its substrates at serine residues located in regions rich in arginine/serine dipeptides, known as RS domains and is involved in the phosphorylation of SR splicing factors and the regulation of splicing. Plays a central role in the regulatory network for splicing, controlling the intranuclear distribution of splicing factors in interphase cells and the reorganization of nuclear speckles during mitosis. Can influence additional steps of mRNA maturation, as well as other cellular activities, such as chromatin reorganization in somatic and sperm cells and cell cycle progression. Isoform 2 phosphorylates SFRS2, ZRSR2, LBR and PRM1. Isoform 2 phosphorylates SRSF1 using a directional (C-terminal to N-terminal) and a dual-track mechanism incorporating both processive phosphorylation (in which the kinase stays attached to the substrate after each round of phosphorylation) and distributive phosphorylation steps (in which the kinase and substrate dissociate after each phosphorylation event). The RS domain of SRSF1 binds first to a docking groove in the large lobe of the kinase domain of SRPK1. This induces certain structural changes in SRPK1 and/or RRM2 domain of SRSF1, allowing RRM2 to bind the kinase and initiate phosphorylation. The cycles continue for several phosphorylation steps in a processive manner (steps 1-8) until the last few phosphorylation steps (approximately steps 9-12). During that time, a mechanical stress induces the unfolding of the beta-4 motif in RRM2, which then docks at the docking groove of SRPK1. This also signals RRM2 to begin to dissociate, which facilitates SRSF1 dissociation after phosphorylation is completed. Isoform 2 can mediate hepatitis B virus (HBV) core protein phosphorylation. It plays a negative role in the regulation of HBV replication through a mechanism not involving the phosphorylation of the core protein but by reducing the packaging efficiency of the pregenomic RNA (pgRNA) without affecting the formation of the viral core particles. Isoform 1 and isoform 2 can induce splicing of exon 10 in MAPT/TAU. The ratio of isoform 1/isoform 2 plays a decisive role in determining cell fate in K-562 leukaemic cell line: isoform 2 favors proliferation where as isoform 1 favors differentiation.
Molecular Weight
74kDa/72kDa/92kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIF-PIHCELISA
Clone
ARC61264
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat
Back to Product Catalog