Antibodies
Anti-SRSF3 Antibody-Oligo Conjugate
SKU: aoc3508
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SRSF3 Antibody-IF1
Antibody Target
- Target
- Serine/arginine-rich splicing factor 3
- UniProt Number
- P84103
- Target Description
- Splicing factor, which binds the consensus motif 5'-C[ACU][AU]C[ACU][AC]C-3' within pre-mRNA and promotes specific exons inclusion during alternative splicing. Interaction with YTHDC1, a RNA-binding protein that recognizes and binds N6-methyladenosine (m6A)-containing RNAs, promotes recruitment of SRSF3 to its mRNA-binding elements adjacent to m6A sites within exons. Also functions as an adapter involved in mRNA nuclear export. Binds mRNA which is thought to be transferred to the NXF1-NXT1 heterodimer for export (TAP/NXF1 pathway); enhances NXF1-NXT1 RNA-binding activity. Involved in nuclear export of m6A-containing mRNAs via interaction with YTHDC1: interaction with YTHDC1 facilitates m6A-containing mRNA-binding to both SRSF3 and NXF1, promoting mRNA nuclear export.
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1394
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat