Antibodies
Anti-SSCA1/SerpinB3 Antibody-Oligo Conjugate
SKU: aoc3509
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SSCA1/SerpinB3 Antibody-IF1
Antibody Target
- Target
- Serpin B3
- UniProt Number
- P29508
- Target Description
- May act as a papain-like cysteine protease inhibitor to modulate the host immune response against tumor cells. Also functions as an inhibitor of UV-induced apoptosis via suppression of the activity of c-Jun NH(2)-terminal kinase (JNK1).
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC63576
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat