Antibodies
Anti-STAR Antibody-Oligo Conjugate
SKU: aoc3514
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-STAR Antibody-IF1
Antibody Target
- Target
- Steroidogenic acute regulatory protein, mitochondrial
- UniProt Number
- P49675
- Target Description
- Plays a key role in steroid hormone synthesis by enhancing the metabolism of cholesterol into pregnenolone. Mediates the transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane where it is cleaved to pregnenolone.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC55812
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat