Antibodies
Anti-STAT4 Antibody-Oligo Conjugate
SKU: aoc3518
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-STAT4 Antibody-IF1
Antibody Target
- Target
- Signal transducer and activator of transcription 4
- UniProt Number
- Q14765
- Target Description
- Transcriptional regulator mainly expressed in hematopoietic cells that plays a critical role in cellular growth, differentiation and immune response. Plays a key role in the differentiation of T-helper 1 cells and the production of interferon-gamma. Also participates in multiple neutrophil functions including chemotaxis and production of the neutrophil extracellular traps. After IL12 binding to its receptor IL12RB2, STAT4 interacts with the intracellular domain of IL12RB2 and becomes tyrosine phosphorylated. Phosphorylated STAT4 then homodimerizes and migrates to the nucleus where it can recognize STAT target sequences present in IL12 responsive genes. Although IL12 appears to be the predominant activating signal, STAT4 can also be phosphorylated and activated in response to IFN-gamma stimulation via JAK1 and TYK2 and in response to different interleukins including IL23, IL2 and IL35. Transcription activation of IFN-gamma gene is mediated by interaction with JUN that forms a complex that efficiently interacts with the AP-1-related sequence of the IFN-gamma promoter. In response to IFN-alpha/beta signaling, acts as a transcriptional repressor and suppresses IL5 and IL13 mRNA expression during response to T-cell receptor (TCR) activation.
- Molecular Weight
- 86kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1071
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat