Antibodies
Anti-STIM1 Antibody-Oligo Conjugate (ARC57102)
SKU: aoc3526
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-STIM1 Antibody (ARC57102)-IF1
Antibody Target
- Target
- Stromal interaction molecule 1
- UniProt Number
- Q13586
- Target Description
- Acts as a Ca(2+) sensor that gates two major inward rectifying Ca(2+) channels at the plasma membrane: Ca(2+) release-activated Ca(2+) (CRAC) channels and arachidonate-regulated Ca(2+)-selective (ARC) channels. Plays a role in mediating store-operated Ca(2+) entry (SOCE), a Ca(2+) influx following depletion of intracellular Ca(2+) stores. Upon Ca(2+) depletion, translocates from the endoplasmic reticulum to the plasma membrane where it activates CRAC channel pore-forming subunits ORA1, ORA2 and ORAI3 to generate sustained and oscillatory Ca(2+) entry. Involved in enamel formation.
- Molecular Weight
- 77kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC57102
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human