Antibodies
Anti-STXBP1 Antibody-Oligo Conjugate
SKU: aoc3530
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-STXBP1 Antibody-IF1
Antibody Target
- Target
- Syntaxin-binding protein 1
- UniProt Number
- P61764
- Target Description
- Participates in the regulation of synaptic vesicle docking and fusion through interaction with GTP-binding proteins. Essential for neurotransmission and binds syntaxin, a component of the synaptic vesicle fusion machinery probably in a 1:1 ratio. Can interact with syntaxins 1, 2, and 3 but not syntaxin 4. Involved in the release of neurotransmitters from neurons through interacting with SNARE complex component STX1A and mediating the assembly of the SNARE complex at synaptic membranes. May play a role in determining the specificity of intracellular fusion reactions.
- Molecular Weight
- 68 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1518
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat