Antibodies
Anti-SUMO 1 Antibody-Oligo Conjugate
SKU: aoc3532
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SUMO 1 Antibody-IF1
Antibody Target
- Target
- Small ubiquitin-related modifier 1
- UniProt Number
- P63165
- Target Description
- Ubiquitin-like protein that can be covalently attached to proteins as a monomer or a lysine-linked polymer. Covalent attachment via an isopeptide bond to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I, and can be promoted by E3 ligases such as PIAS1-4, RANBP2 or CBX4. This post-translational modification on lysine residues of proteins plays a crucial role in a number of cellular processes such as nuclear transport, DNA replication and repair, mitosis and signal transduction. Involved for instance in targeting RANGAP1 to the nuclear pore complex protein RANBP2. Covalently attached to the voltage-gated potassium channel KCNB1; this modulates the gating characteristics of KCNB1. Polymeric SUMO1 chains are also susceptible to polyubiquitination which functions as a signal for proteasomal degradation of modified proteins. May also regulate a network of genes involved in palate development. Covalently attached to ZFHX3.
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0215
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat