Antibodies
Anti-SUMO4 Antibody-Oligo Conjugate
SKU: aoc3534
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SUMO4 Antibody-IF1
Antibody Target
- Target
- Small ubiquitin-related modifier 4
- UniProt Number
- Q6EEV6
- Target Description
- Ubiquitin-like protein which can be covalently attached to target lysines as a monomer. Does not seem to be involved in protein degradation and may modulate protein subcellular localization, stability or activity. Upon oxidative stress, conjugates to various anti-oxidant enzymes, chaperones, and stress defense proteins. May also conjugate to NFKBIA, TFAP2A and FOS, negatively regulating their transcriptional activity, and to NR3C1, positively regulating its transcriptional activity. Covalent attachment to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I.
- Molecular Weight
- 11kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1382
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat