Antibodies
Anti-SUN2 Antibody-Oligo Conjugate
SKU: aoc3535
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-SUN2 Antibody-IF1
Antibody Target
- Target
- SUN domain-containing protein 2
- UniProt Number
- Q9UH99
- Target Description
- As a component of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex, involved in the connection between the nuclear lamina and the cytoskeleton. The nucleocytoplasmic interactions established by the LINC complex play an important role in the transmission of mechanical forces across the nuclear envelope and in nuclear movement and positioning. Specifically, SYNE2 and SUN2 assemble in arrays of transmembrane actin-associated nuclear (TAN) lines which are bound to F-actin cables and couple the nucleus to retrograde actin flow during actin-dependent nuclear movement. Required for interkinetic nuclear migration (INM) and essential for nucleokinesis and centrosome-nucleus coupling during radial neuronal migration in the cerebral cortex and during glial migration. Required for nuclear migration in retinal photoreceptor progenitors implicating association with cytoplasmic dynein-dynactin and kinesin motor complexes, and probably B-type lamins; SUN1 and SUN2 seem to act redundantly. The SUN1/2:KASH5 LINC complex couples telomeres to microtubules during meiosis; SUN1 and SUN2 seem to act at least partial redundantly. Anchors chromosome movement in the prophase of meiosis and is involved in selective gene expression of coding and non-coding RNAs needed for gametogenesis. Required for telomere attachment to nuclear envelope and gametogenesis. May also function on endocytic vesicles as a receptor for RAB5-GDP and participate in the activation of RAB5.
- Molecular Weight
- 80kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2311
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat