Antibodies
Anti-Syndecan-1 Antibody-Oligo Conjugate (ARC0918)
SKU: aoc3546
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Syndecan-1 Antibody (ARC0918)-IF1
Antibody Target
- Target
- Syndecan-1
- UniProt Number
- P18827
- Target Description
- Cell surface proteoglycan that contains both heparan sulfate and chondroitin sulfate and that links the cytoskeleton to the interstitial matrix. Regulates exosome biogenesis in concert with SDCBP and PDCD6IP. Able to induce its own expression in dental mesenchymal cells and also in the neighboring dental epithelial cells via an MSX1-mediated pathway.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0918
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat