Antibodies
Anti-Syntaxin 1A Antibody-Oligo Conjugate
SKU: aoc3550
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Syntaxin 1A Antibody-IF1
Antibody Target
- Target
- Syntaxin-1A
- UniProt Number
- Q16623
- Target Description
- Plays an essential role in hormone and neurotransmitter calcium-dependent exocytosis and endocytosis. Part of the SNARE (Soluble NSF Attachment Receptor) complex composed of SNAP25, STX1A and VAMP2 which mediates the fusion of synaptic vesicles with the presynaptic plasma membrane. STX1A and SNAP25 are localized on the plasma membrane while VAMP2 resides in synaptic vesicles. The pairing of the three SNAREs from the N-terminal SNARE motifs to the C-terminal anchors leads to the formation of the SNARE complex, which brings membranes into close proximity and results in final fusion. Participates in the calcium-dependent regulation of acrosomal exocytosis in sperm. Also plays an important role in the exocytosis of hormones such as insulin or glucagon-like peptide 1 (GLP-1).
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2403
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat