Antibodies
Anti-Syntenin Antibody-Oligo Conjugate
SKU: aoc3553
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Syntenin Antibody-IF1
Antibody Target
- Target
- Syntenin-1
- UniProt Number
- O00560
- Target Description
- Multifunctional adapter protein involved in diverse array of functions including trafficking of transmembrane proteins, neuro and immunomodulation, exosome biogenesis, and tumorigenesis. Positively regulates TGFB1-mediated SMAD2/3 activation and TGFB1-induced epithelial-to-mesenchymal transition (EMT) and cell migration in various cell types. May increase TGFB1 signaling by enhancing cell-surface expression of TGFR1 by preventing the interaction between TGFR1 and CAV1 and subsequent CAV1-dependent internalization and degradation of TGFR1. In concert with SDC1/4 and PDCD6IP, regulates exosome biogenesis. Regulates migration, growth, proliferation, and cell cycle progression in a variety of cancer types. In adherens junctions may function to couple syndecans to cytoskeletal proteins or signaling components. Seems to couple transcription factor SOX4 to the IL-5 receptor (IL5RA). May also play a role in vesicular trafficking. Seems to be required for the targeting of TGFA to the cell surface in the early secretory pathway.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1410
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat