Antibodies
Anti-TAB1 Antibody-Oligo Conjugate
SKU: aoc3557
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TAB1 Antibody-IF1
Antibody Target
- Target
- TGF-beta-activated kinase 1 and MAP3K7-binding protein 1
- UniProt Number
- Q15750
- Target Description
- Key adapter protein that plays an essential role in JNK and NF-kappa-B activation and proinflammatory cytokines production in response to stimulation with TLRs and cytokines. Mechanistically, associates with the catalytic domain of MAP3K7/TAK1 to trigger MAP3K7/TAK1 autophosphorylation leading to its full activation. Similarly, associates with MAPK14 and triggers its autophosphorylation and subsequent activation. In turn, MAPK14 phosphorylates TAB1 and inhibits MAP3K7/TAK1 activation in a feedback control mechanism. Also plays a role in recruiting MAPK14 to the TAK1 complex for the phosphorylation of the TAB2 and TAB3 regulatory subunits.
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1943
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat