Antibodies
Anti-TACC3 Antibody-Oligo Conjugate
SKU: aoc3559
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TACC3 Antibody-IF1
Antibody Target
- Target
- Transforming acidic coiled-coil-containing protein 3
- UniProt Number
- Q9Y6A5
- Target Description
- Plays a role in the microtubule-dependent coupling of the nucleus and the centrosome. Involved in the processes that regulate centrosome-mediated interkinetic nuclear migration (INM) of neural progenitors. Acts as a component of the TACC3/ch-TOG/clathrin complex proposed to contribute to stabilization of kinetochore fibers of the mitotic spindle by acting as inter-microtubule bridge. The TACC3/ch-TOG/clathrin complex is required for the maintenance of kinetochore fiber tension. May be involved in the control of cell growth and differentiation. May contribute to cancer.
- Molecular Weight
- 90kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2195
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat