Antibodies
Anti-Talin 2 Antibody-Oligo Conjugate
SKU: aoc3562
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Talin 2 Antibody-IF1
Antibody Target
- Target
- Talin-2
- UniProt Number
- Q9Y4G6
- Target Description
- As a major component of focal adhesion plaques that links integrin to the actin cytoskeleton, may play an important role in cell adhesion. Recruits PIP5K1C to focal adhesion plaques and strongly activates its kinase activity.
- Molecular Weight
- 272kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2335
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat