Antibodies
Anti-TAP2 Antibody-Oligo Conjugate
SKU: aoc3565
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TAP2 Antibody-IF1
Antibody Target
- Target
- Antigen peptide transporter 2
- UniProt Number
- Q03519
- Target Description
- ABC transporter associated with antigen processing. In complex with TAP1 mediates unidirectional translocation of peptide antigens from cytosol to endoplasmic reticulum (ER) for loading onto MHC class I (MHCI) molecules. Uses the chemical energy of ATP to export peptides against the concentration gradient. During the transport cycle alternates between 'inward-facing' state with peptide binding site facing the cytosol to 'outward-facing' state with peptide binding site facing the ER lumen. Peptide antigen binding to ATP-loaded TAP1-TAP2 induces a switch to hydrolysis-competent 'outward-facing' conformation ready for peptide loading onto nascent MHCI molecules. Subsequently ATP hydrolysis resets the transporter to the 'inward facing' state for a new cycle. Typically transports intracellular peptide antigens of 8 to 13 amino acids that arise from cytosolic proteolysis via IFNG-induced immunoproteasome. Binds peptides with free N- and C-termini, the first three and the C-terminal residues being critical. Preferentially selects peptides having a highly hydrophobic residue at position 3 and hydrophobic or charged residues at the C-terminal anchor. Proline at position 2 has the most destabilizing effect. As a component of the peptide loading complex (PLC), acts as a molecular scaffold essential for peptide-MHCI assembly and antigen presentation.
- Molecular Weight
- 76kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC65458
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse