Antibodies
Anti-TBR1 Antibody-Oligo Conjugate
SKU: aoc3572
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TBR1 Antibody-IF1
Antibody Target
- Target
- T-box brain protein 1
- UniProt Number
- Q16650
- Target Description
- Transcriptional repressor involved in multiple aspects of cortical development, including neuronal migration, laminar and areal identity, and axonal projection. As transcriptional repressor of FEZF2, it blocks the formation of the corticospinal (CS) tract from layer 6 projection neurons, thereby restricting the origin of CS axons specifically to layer 5 neurons.
- Molecular Weight
- 74 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC3309
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat