Antibodies
Anti-TCIRG1 Antibody-Oligo Conjugate
SKU: aoc3578
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TCIRG1 Antibody-IF1
Antibody Target
- Target
- V-type proton ATPase 116 kDa subunit a 3
- UniProt Number
- Q13488
- Target Description
- Subunit of the V0 complex of vacuolar(H+)-ATPase (V-ATPase), a multisubunit enzyme composed of a peripheral complex (V1) that hydrolyzes ATP and a membrane integral complex (V0) that translocates protons. V-ATPase is responsible for acidifying and maintaining the pH of intracellular compartments and in some cell types, is targeted to the plasma membrane, where it is responsible for acidifying the extracellular environment. Seems to be directly involved in T-cell activation.
- Molecular Weight
- 93kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC64630
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat