Antibodies
Anti-TEAD1 Antibody-Oligo Conjugate
SKU: aoc3584
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-TEAD1 Antibody-PLA1
Antibody Target
- Target
- Transcriptional enhancer factor TEF-1
- UniProt Number
- P28347
- Target Description
- Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction. Binds specifically and cooperatively to the SPH and GT-IIC 'enhansons' (5'-GTGGAATGT-3') and activates transcription in vivo in a cell-specific manner. The activation function appears to be mediated by a limiting cell-specific transcriptional intermediary factor (TIF). Involved in cardiac development. Binds to the M-CAT motif.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISAChIPCUT&Tag
- Clone
- ARC1157
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat