Antibodies

Anti-TFE3 Antibody-Oligo Conjugate

SKU: aoc3593

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-TFE3 Antibody-IF1

Antibody Target

Target
Transcription factor E3
UniProt Number
P19532
Target Description
Transcription factor that acts as a master regulator of lysosomal biogenesis and immune response. Specifically recognizes and binds E-box sequences (5'-CANNTG-3'); efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFEB or MITF. Involved in the cellular response to amino acid availability by acting downstream of MTOR: in the presence of nutrients, TFE3 phosphorylation by MTOR promotes its inactivation. Upon starvation or lysosomal stress, inhibition of MTOR induces TFE3 dephosphorylation, resulting in transcription factor activity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression, thereby playing a central role in expression of lysosomal genes. Maintains the pluripotent state of embryonic stem cells by promoting the expression of genes such as ESRRB; mTOR-dependent TFE3 cytosolic retention and inactivation promotes exit from pluripotency. Required to maintain the naive pluripotent state of hematopoietic stem cell; mTOR-dependent cytoplasmic retention of TFE3 promotes the exit of hematopoietic stem cell from pluripotency. TFE3 activity is also involved in the inhibition of neuronal progenitor differentiation. Acts as a positive regulator of browning of adipose tissue by promoting expression of target genes; mTOR-dependent phosphorylation promotes cytoplasmic retention of TFE3 and inhibits browning of adipose tissue. In association with TFEB, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity. Specifically recognizes the MUE3 box, a subset of E-boxes, present in the immunoglobulin enhancer. It also binds very well to a USF/MLTF site. Promotes TGF-beta-induced transcription of COL1A2; via its interaction with TSC22D1 at E-boxes in the gene proximal promoter. May regulate lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1.
Molecular Weight
62 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC1829
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat