Antibodies
Anti-TFEB Antibody-Oligo Conjugate
SKU: aoc3594
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TFEB Antibody-IF1
Antibody Target
- Target
- Transcription factor EB
- UniProt Number
- P19484
- Target Description
- Transcription factor that acts as a master regulator of lysosomal biogenesis, autophagy, lysosomal exocytosis, lipid catabolism, energy metabolism and immune response. Specifically recognizes and binds E-box sequences (5'-CANNTG-3'); efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFE3 or MITF. Involved in the cellular response to amino acid availability by acting downstream of MTOR: in the presence of nutrients, TFEB phosphorylation by MTOR promotes its cytosolic retention and subsequent inactivation. Upon starvation or lysosomal stress, inhibition of MTOR induces TFEB dephosphorylation, resulting in nuclear localization and transcription factor activity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression, thereby playing a central role in expression of lysosomal genes. Regulates lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1. Acts as a positive regulator of autophagy by promoting expression of genes involved in autophagy. In association with TFE3, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity. Specifically recognizes the gamma-E3 box, a subset of E-boxes, present in the heavy-chain immunoglobulin enhancer. Plays a role in the signal transduction processes required for normal vascularization of the placenta. Involved in the immune response to infection by the bacteria S.aureus, S.typhimurium or S.enterica: infection promotes itaconate production, leading to alkylation, resulting in nuclear localization and transcription factor activity. Itaconate-mediated alkylation activates TFEB-dependent lysosomal biogenesis, facilitating the bacteria clearance during the antibacterial innate immune response. In association with ACSS2, promotes the expression of genes involved in lysosome biogenesis and both autophagy upon glucose deprivation.
- Molecular Weight
- 44kDa/53kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISAChIP
- Clone
- ARC68094
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat