Antibodies
Anti-TGF beta 1 Antibody-Oligo Conjugate
SKU: aoc3599
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TGF beta 1 Antibody-IF1
Antibody Target
- Target
- Transforming growth factor beta-1 proprotein [Cleaved into: Latency-associated peptide
- UniProt Number
- P01137
- Target Description
- Transforming growth factor beta-1 proprotein: Precursor of the Latency-associated peptide (LAP) and Transforming growth factor beta-1 (TGF-beta-1) chains, which constitute the regulatory and active subunit of TGF-beta-1, respectively.; FUNCTION: [Latency-associated peptide]: Required to maintain the Transforming growth factor beta-1 (TGF-beta-1) chain in a latent state during storage in extracellular matrix. Associates non-covalently with TGF-beta-1 and regulates its activation via interaction with 'milieu molecules', such as LTBP1, LRRC32/GARP and LRRC33/NRROS, that control activation of TGF-beta-1. Interaction with LRRC33/NRROS regulates activation of TGF-beta-1 in macrophages and microglia (Probable). Interaction with LRRC32/GARP controls activation of TGF-beta-1 on the surface of activated regulatory T-cells (Tregs). Interaction with integrins (ITGAV:ITGB6 or ITGAV:ITGB8) results in distortion of the Latency-associated peptide chain and subsequent release of the active TGF-beta-1.; FUNCTION: [Transforming growth factor beta-1]: Multifunctional protein that regulates the growth and differentiation of various cell types and is involved in various processes, such as normal development, immune function, microglia function and responses to neurodegeneration. Activation into mature form follows different steps: following cleavage of the proprotein in the Golgi apparatus, Latency-associated peptide (LAP) and Transforming growth factor beta-1 (TGF-beta-1) chains remain non-covalently linked rendering TGF-beta-1 inactive during storage in extracellular matrix. At the same time, LAP chain interacts with 'milieu molecules', such as LTBP1, LRRC32/GARP and LRRC33/NRROS that control activation of TGF-beta-1 and maintain it in a latent state during storage in extracellular milieus. TGF-beta-1 is released from LAP by integrins (ITGAV:ITGB6 or ITGAV:ITGB8): integrin-binding to LAP stabilizes an alternative conformation of the LAP bowtie tail and results in distortion of the LAP chain and subsequent release of the active TGF-beta-1. Once activated following release of LAP, TGF-beta-1 acts by binding to TGF-beta receptors (TGFBR1 and TGFBR2), which transduce signal. While expressed by many cells types, TGF-beta-1 only has a very localized range of action within cell environment thanks to fine regulation of its activation by Latency-associated peptide chain (LAP) and 'milieu molecules'. Plays an important role in bone remodeling: acts as a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Can promote either T-helper 17 cells (Th17) or regulatory T-cells (Treg) lineage differentiation in a concentration-dependent manner. At high concentrations, leads to FOXP3-mediated suppression of RORC and down-regulation of IL-17 expression, favoring Treg cell development. At low concentrations in concert with IL-6 and IL-21, leads to expression of the IL-17 and IL-23 receptors, favoring differentiation to Th17 cells. Stimulates sustained production of collagen through the activation of CREB3L1 by regulated intramembrane proteolysis (RIP). Mediates SMAD2/3 activation by inducing its phosphorylation and subsequent translocation to the nucleus. Positively regulates odontoblastic differentiation in dental papilla cells, via promotion of IPO7-mediated translocation of phosphorylated SMAD2 to the nucleus and subsequent transcription of target genes. Can induce epithelial-to-mesenchymal transition (EMT) and cell migration in various cell types.
- Molecular Weight
- 44kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC3248
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat