Antibodies
Anti-Thioredoxin 2 (Trx2/TXN2) Antibody-Oligo Conjugate
SKU: aoc3607
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Thioredoxin 2 (Trx2/TXN2) Antibody-IF1
Antibody Target
- Target
- Thioredoxin, mitochondrial
- UniProt Number
- Q99757
- Target Description
- Important for the control of mitochondrial reactive oxygen species homeostasis, apoptosis regulation and cell viability Is involved in various redox reactions including the reduction of protein disulfide bonds, through the reversible oxidation of its active center dithiol to a disulfide.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1003
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat