Antibodies
Anti-Thioredoxin Antibody-Oligo Conjugate
SKU: aoc3606
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Thioredoxin Antibody-IF1
Antibody Target
- Target
- Thioredoxin
- UniProt Number
- P10599
- Target Description
- Participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions. Plays a role in the reversible S-nitrosylation of cysteine residues in target proteins, and thereby contributes to the response to intracellular nitric oxide. Nitrosylates the active site Cys of CASP3 in response to nitric oxide (NO), and thereby inhibits caspase-3 activity. Induces the FOS/JUN AP-1 DNA-binding activity in ionizing radiation (IR) cells through its oxidation/reduction status and stimulates AP-1 transcriptional activity.; FUNCTION: ADF augments the expression of the interleukin-2 receptor TAC (IL2R/P55).
- Molecular Weight
- 12 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2658
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat