Antibodies
Anti-Thymidylate Synthase Antibody-Oligo Conjugate (ARC65474)
SKU: aoc3610
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Thymidylate Synthase Antibody (ARC65474)-IF1
Antibody Target
- Target
- Thymidylate synthase
- UniProt Number
- P04818
- Target Description
- Catalyzes the reductive methylation of 2'-deoxyuridine 5'-monophosphate (dUMP) to thymidine 5'-monophosphate (dTMP), using the cosubstrate, 5,10- methylenetetrahydrofolate (CH2H4folate) as a 1-carbon donor and reductant and contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC65474
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human