Antibodies
Anti-Thyroglobulin Antibody-Oligo Conjugate
SKU: aoc3612
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Thyroglobulin Antibody-IF1
Antibody Target
- Target
- Thyroglobulin
- UniProt Number
- P01266
- Target Description
- Acts as a substrate for the production of iodinated thyroid hormones thyroxine (T4) and triiodothyronine (T3). The synthesis of T3 and T4 involves iodination of selected tyrosine residues of TG/thyroglobulin followed by their oxidative coupling in the thyroid follicle lumen. Following TG re-internalization and lysosomal-mediated proteolysis, T3 and T4 are released from the polypeptide backbone leading to their secretion into the bloodstream. One dimer produces 7 thyroid hormone molecules.
- Molecular Weight
- 305kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC1971
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat