Antibodies
Anti-TIM50 Antibody-Oligo Conjugate
SKU: aoc3617
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TIM50 Antibody-IF1
Antibody Target
- Target
- Mitochondrial import inner membrane translocase subunit TIM50
- UniProt Number
- Q3ZCQ8
- Target Description
- Essential component of the TIM23 complex, a complex that mediates the translocation of transit peptide-containing proteins across the mitochondrial inner membrane. Has some phosphatase activity in vitro; however such activity may not be relevant in vivo.; FUNCTION: [Isoform 2]: May participate in the release of snRNPs and SMN from the Cajal body.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC1883
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat