Antibodies
Anti-TIMM13 Antibody-Oligo Conjugate
SKU: aoc3620
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TIMM13 Antibody-IF1
Antibody Target
- Target
- Mitochondrial import inner membrane translocase subunit Tim13
- UniProt Number
- Q9Y5L4
- Target Description
- Mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. Also required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space. The TIMM8-TIMM13 complex mediates the import of proteins such as TIMM23, SLC25A12/ARALAR1 and SLC25A13/ARALAR2, while the predominant TIMM9-TIMM10 70 kDa complex mediates the import of much more proteins.
- Molecular Weight
- 11kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC65133
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human