Antibodies
Anti-TLE2 Antibody-Oligo Conjugate
SKU: aoc3628
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TLE2 Antibody-IF1
Antibody Target
- Target
- Transducin-like enhancer protein 2
- UniProt Number
- Q04725
- Target Description
- Transcriptional corepressor that binds to a number of transcription factors. Inhibits the transcriptional activation mediated by CTNNB1 and TCF family members in Wnt signaling. The effects of full-length TLE family members may be modulated by association with dominant-negative AES.
- Molecular Weight
- 80KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61201
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat