Antibodies
Anti-TLR2 Antibody-Oligo Conjugate (ARC71867)
SKU: aoc3631
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TLR2 Antibody (ARC71867)-IF1
Antibody Target
- Target
- Toll-like receptor 2
- UniProt Number
- O60603
- Target Description
- Cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. Cooperates with TLR1 or TLR6 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. May also activate immune cells and promote apoptosis in response to the lipid moiety of lipoproteins. Recognizes mycoplasmal macrophage-activating lipopeptide-2kD (MALP-2), soluble tuberculosis factor (STF), phenol-soluble modulin (PSM) and B.burgdorferi outer surface protein A lipoprotein (OspA-L) cooperatively with TLR6. Stimulation of monocytes in vitro with M.tuberculosis PstS1 induces p38 MAPK and ERK1/2 activation primarily via this receptor, but also partially via TLR4. MAPK activation in response to bacterial peptidoglycan also occurs via this receptor. Acts as a receptor for M.tuberculosis lipoproteins LprA, LprG, LpqH and PstS1, some lipoproteins are dependent on other coreceptors (TLR1, CD14 and/or CD36); the lipoproteins act as agonists to modulate antigen presenting cell functions in response to the pathogen. M.tuberculosis HSP70 (dnaK) but not HSP65 (groEL-2) acts via this protein to stimulate NF-kappa-B expression. Recognizes M.tuberculosis major T-antigen EsxA (ESAT-6) which inhibits downstream MYD88-dependent signaling (shown in mouse). Forms activation clusters composed of several receptors depending on the ligand, these clusters trigger signaling from the cell surface and subsequently are targeted to the Golgi in a lipid-raft dependent pathway. Forms the cluster TLR2:TLR6:CD14:CD36 in response to diacylated lipopeptides and TLR2:TLR1:CD14 in response to triacylated lipopeptides. Required for normal uptake of M.tuberculosis, a process that is inhibited by M.tuberculosis LppM.
- Molecular Weight
- 90kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC71867
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse