Antibodies
Anti-TMEM119 Antibody-Oligo Conjugate
SKU: aoc3634
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TMEM119 Antibody-IF1
Antibody Target
- Target
- Transmembrane protein 119
- UniProt Number
- Q4V9L6
- Target Description
- Plays an important role in bone formation and normal bone mineralization. Promotes the differentiation of myoblasts into osteoblasts. May induce the commitment and differentiation of myoblasts into osteoblasts through an enhancement of BMP2 production and interaction with the BMP-RUNX2 pathway. Up-regulates the expression of ATF4, a transcription factor which plays a central role in osteoblast differentiation. Essential for normal spermatogenesis and late testicular differentiation.
- Molecular Weight
- 29 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-FIF-PIHCmIHCELISA
- Clone
- ARC5161
- Isotype
- IgG. Mouse-derived rabbit chimeric antibody
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat