Antibodies
Anti-TMEM16A Antibody-Oligo Conjugate
SKU: aoc3635
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TMEM16A Antibody-IF1
Antibody Target
- Target
- Anoctamin-1
- UniProt Number
- Q5XXA6
- Target Description
- Calcium-activated chloride channel (CaCC). Plays a role in transepithelial anion transport and smooth muscle contraction. Required for the normal functioning of the interstitial cells of Cajal (ICCs) which generate electrical pacemaker activity in gastrointestinal smooth muscles. Acts as a major contributor to basal and stimulated chloride conductance in airway epithelial cells and plays an important role in tracheal cartilage development. Required for CFTR activation by enhancing endoplasmic reticulum Ca(2+) store release and is also required for CFTR membrane expression. Required for basal and ATP-dependent mucus secretion in airways and intestine, probably by controlling exocytosis of mucus-filled granules by providing Ca(2+) to an apical signaling compartment. Contributes to airway mucus expression induced by interleukins IL3 and IL8 and by the asthma-associated protein CLCA1 and is required for expression of mucin MUC5AC. However, was shown in another study not to be required for MUC5AC expression. Plays a role in the propagation of Ca(2+) waves in Kolliker's organ in the cochlea and contributes to the refinement of auditory brainstem circuitries prior to hearing onset. In vomeronasal sensory neurons, modulates spontaneous firing patterns in the absence of stimuli as well as the firing pattern of pheromone-evoked activity. Responsible for calcium-activated chloride channel activity in type I taste cells of the vallate papillae. Acts as a heat sensor in nociceptive neurons. In dorsal root ganglion neurons, plays a role in mediating non-histaminergic Mas-related G-protein coupled receptor (MRGPR)-dependent itching, acting as a downstream effector of MRGPRs. In the developing brain, required for the Ca(2+)-dependent process extension of radial glial cells.; FUNCTION: [Isoform 4]: Calcium-activated chloride channel (CaCC). Contributes to calcium-activated chloride secretion in human sweat gland epithelial cells. Shows increased basal chloride permeability and decreased Ca(2+)-induced chloride permeability.; FUNCTION: [Isoform 5]: Calcium-activated chloride channel (CaCC). Shows increased sensitivity to intracellular Ca(2+).
- Molecular Weight
- 74-120 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC79124
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat