Antibodies
Anti-TMPRSS2 Antibody-Oligo Conjugate
SKU: aoc3640
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TMPRSS2 Antibody-IF1
Antibody Target
- Target
- Transmembrane protease serine 2
- UniProt Number
- O15393
- Target Description
- Plasma membrane-anchored serine protease that cleaves at arginine residues. Participates in proteolytic cascades of relevance for the normal physiologic function of the prostate. Androgen-induced TMPRSS2 activates several substrates that include pro-hepatocyte growth factor/HGF, the protease activated receptor-2/F2RL1 or matriptase/ST14 leading to extracellular matrix disruption and metastasis of prostate cancer cells. In addition, activates trigeminal neurons and contribute to both spontaneous pain and mechanical allodynia.; FUNCTION: (Microbial infection) Facilitates human coronaviruses SARS-CoV and SARS-CoV-2 infections via two independent mechanisms, proteolytic cleavage of ACE2 receptor which promotes viral uptake, and cleavage of coronavirus spike glycoproteins which activates the glycoprotein for host cell entry. The cleavage of SARS-COV2 spike glycoprotein occurs between the S2 and S2' site. Upon SARS-CoV-2 infection, increases syncytia formation by accelerating the fusion process. Proteolytically cleaves and activates the spike glycoproteins of human coronavirus 229E (HCoV-229E) and human coronavirus EMC (HCoV-EMC) and the fusion glycoproteins F0 of Sendai virus (SeV), human metapneumovirus (HMPV), human parainfluenza 1, 2, 3, 4a and 4b viruses (HPIV). Essential for spread and pathogenesis of influenza A virus (strains H1N1, H3N2 and H7N9); involved in proteolytic cleavage and activation of hemagglutinin (HA) protein which is essential for viral infectivity.; FUNCTION: (Microbial infection) Receptor for human coronavirus HKU1-CoV, acts synergistically with disialoside glycans to facilitate the entry of the virus. After binding to cell-surface disialoside glycans, the viral S protein interacts with the inactive form of TMPRSS2 and inhibits its protease activity.
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1439
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat