Antibodies
Anti-TNF alpha Antibody-Oligo Conjugate (ARC52531)
SKU: aoc3642
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TNF alpha Antibody (ARC52531)-IF1
Antibody Target
- Target
- Tumor necrosis factor
- UniProt Number
- P01375
- Target Description
- Cytokine that binds to TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. It is mainly secreted by macrophages and can induce cell death of certain tumor cell lines. It is potent pyrogen causing fever by direct action or by stimulation of interleukin-1 secretion and is implicated in the induction of cachexia, Under certain conditions it can stimulate cell proliferation and induce cell differentiation. Impairs regulatory T-cells (Treg) function in individuals with rheumatoid arthritis via FOXP3 dephosphorylation. Up-regulates the expression of protein phosphatase 1 (PP1), which dephosphorylates the key 'Ser-418' residue of FOXP3, thereby inactivating FOXP3 and rendering Treg cells functionally defective. Key mediator of cell death in the anticancer action of BCG-stimulated neutrophils in combination with DIABLO/SMAC mimetic in the RT4v6 bladder cancer cell line. Induces insulin resistance in adipocytes via inhibition of insulin-induced IRS1 tyrosine phosphorylation and insulin-induced glucose uptake. Induces GKAP42 protein degradation in adipocytes which is partially responsible for TNF-induced insulin resistance. Plays a role in angiogenesis by inducing VEGF production synergistically with IL1B and IL6. Promotes osteoclastogenesis and therefore mediates bone resorption.; FUNCTION: The TNF intracellular domain (ICD) form induces IL12 production in dendritic cells.
- Molecular Weight
- 26 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCELISA
- Clone
- ARC52531
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human