Antibodies
Anti-TNFAIP3 Antibody-Oligo Conjugate
SKU: aoc3643
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TNFAIP3 Antibody-IF1
Antibody Target
- Target
- Tumor necrosis factor alpha-induced protein 3
- UniProt Number
- P21580
- Target Description
- Ubiquitin-editing enzyme that contains both ubiquitin ligase and deubiquitinase activities. Involved in immune and inflammatory responses signaled by cytokines, such as TNF-alpha and IL-1 beta, or pathogens via Toll-like receptors (TLRs) through terminating NF-kappa-B activity. Essential component of a ubiquitin-editing protein complex, comprising also RNF11, ITCH and TAX1BP1, that ensures the transient nature of inflammatory signaling pathways. In cooperation with TAX1BP1 promotes disassembly of E2-E3 ubiquitin protein ligase complexes in IL-1R and TNFR-1 pathways; affected are at least E3 ligases TRAF6, TRAF2 and BIRC2, and E2 ubiquitin-conjugating enzymes UBE2N and UBE2D3. In cooperation with TAX1BP1 promotes ubiquitination of UBE2N and proteasomal degradation of UBE2N and UBE2D3. Upon TNF stimulation, deubiquitinates 'Lys-63'-polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NF-kappa-B. Deubiquitinates TRAF6 probably acting on 'Lys-63'-linked polyubiquitin. Upon T-cell receptor (TCR)-mediated T-cell activation, deubiquitinates 'Lys-63'-polyubiquitin chains on MALT1 thereby mediating disassociation of the CBM (CARD11:BCL10:MALT1) and IKK complexes and preventing sustained IKK activation. Deubiquitinates NEMO/IKBKG; the function is facilitated by TNIP1 and leads to inhibition of NF-kappa-B activation. Upon stimulation by bacterial peptidoglycans, probably deubiquitinates RIPK2. Can also inhibit I-kappa-B-kinase (IKK) through a non-catalytic mechanism which involves polyubiquitin; polyubiquitin promotes association with IKBKG and prevents IKK MAP3K7-mediated phosphorylation. Targets TRAF2 for lysosomal degradation. In vitro able to deubiquitinate 'Lys-11'-, 'Lys-48'- and 'Lys-63' polyubiquitin chains. Inhibitor of programmed cell death. Has a role in the function of the lymphoid system. Required for LPS-induced production of pro-inflammatory cytokines and IFN beta in LPS-tolerized macrophages.
- Molecular Weight
- 90kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0355
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human