Antibodies
Anti-TNPO3 Antibody-Oligo Conjugate
SKU: aoc3648
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TNPO3 Antibody-IF1
Antibody Target
- Target
- Transportin-3
- UniProt Number
- Q9Y5L0
- Target Description
- Importin, which transports target proteins into the nucleus. Specifically mediates the nuclear import of splicing factor serine/arginine (SR) proteins, such as RBM4, SFRS1 and SFRS2, by recognizing phosphorylated SR domains. Also mediates the nuclear import of serine/arginine (SR) protein CPSF6, independently of CPSF6 phosphorylation. The nuclear import process is regulated by the small GTPase Ran that partitions between cytoplasm and nucleus in the predominantly GDP- and GTP-bound form, respectively. Importin associates with target cargo proteins in the cytoplasm, and the competitive binding of GTP-bound Ran induces the release of cargos in the nucleus.; FUNCTION: (Microbial infection) Involved in immunodeficiency virus (HIV-1) infection by importing the pre-integration complex (PIC) into the nucleus. Required for a nuclear maturation step of HIV-1 prior to integration.
- Molecular Weight
- 104kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC2310
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat