Antibodies
Anti-Tollip Antibody-Oligo Conjugate
SKU: aoc3649
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Tollip Antibody-IF1
Antibody Target
- Target
- Toll-interacting protein
- UniProt Number
- Q9H0E2
- Target Description
- Component of the signaling pathway of IL-1 and Toll-like receptors. Inhibits cell activation by microbial products. Recruits IRAK1 to the IL-1 receptor complex. Inhibits IRAK1 phosphorylation and kinase activity. Connects the ubiquitin pathway to autophagy by functioning as a ubiquitin-ATG8 family adapter and thus mediating autophagic clearance of ubiquitin conjugates. The TOLLIP-dependent selective autophagy pathway plays an important role in clearance of cytotoxic polyQ proteins aggregates. In a complex with TOM1, recruits ubiquitin-conjugated proteins onto early endosomes. Binds to phosphatidylinositol 3-phosphate (PtdIns(3)P).
- Molecular Weight
- 22kDa/30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61374
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat