Antibodies
Anti-TOM22 Antibody-Oligo Conjugate
SKU: aoc3650
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TOM22 Antibody-IF1
Antibody Target
- Target
- Mitochondrial import receptor subunit TOM22 homolog
- UniProt Number
- Q9NS69
- Target Description
- Central receptor component of the translocase of the outer membrane of mitochondria (TOM complex) responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. Together with the peripheral receptor TOM20 functions as the transit peptide receptor and facilitates the movement of preproteins into the translocation pore. Required for the translocation across the mitochondrial outer membrane of cytochrome P450 monooxygenases.
- Molecular Weight
- 16kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC1688
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat