Antibodies
Anti-TOMM40 Antibody-Oligo Conjugate
SKU: aoc3653
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TOMM40 Antibody-IF1
Antibody Target
- Target
- Mitochondrial import receptor subunit TOM40 homolog
- UniProt Number
- O96008
- Target Description
- Channel-forming protein essential for import of protein precursors into mitochondria. Plays a role in the assembly of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) by forming a complex with BCAP31 and mediating the translocation of Complex I components from the cytosol to the mitochondria.
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCICCELISA
- Clone
- ARC63318
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat