Antibodies
Anti-TOP1 Antibody-Oligo Conjugate
SKU: aoc3655
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TOP1 Antibody-IF1
Antibody Target
- Target
- DNA topoisomerase 1
- UniProt Number
- P11387
- Target Description
- Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex. Introduces a single-strand break via transesterification at a target site in duplex DNA. The scissile phosphodiester is attacked by the catalytic tyrosine of the enzyme, resulting in the formation of a DNA-(3'-phosphotyrosyl)-enzyme intermediate and the expulsion of a 5'-OH DNA strand. The free DNA strand then rotates around the intact phosphodiester bond on the opposing strand, thus removing DNA supercoils. Finally, in the religation step, the DNA 5'-OH attacks the covalent intermediate to expel the active-site tyrosine and restore the DNA phosphodiester backbone. Regulates the alternative splicing of tissue factor (F3) pre-mRNA in endothelial cells. Involved in the circadian transcription of the core circadian clock component BMAL1 by altering the chromatin structure around the ROR response elements (ROREs) on the BMAL1 promoter.
- Molecular Weight
- 91kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0708
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat