Antibodies
Anti-TorsinA/TOR1A Antibody-Oligo Conjugate
SKU: aoc3659
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TorsinA/TOR1A Antibody-IF1
Antibody Target
- Target
- Torsin-1A
- UniProt Number
- O14656
- Target Description
- Protein with chaperone functions important for the control of protein folding, processing, stability and localization as well as for the reduction of misfolded protein aggregates. Involved in the regulation of synaptic vesicle recycling, controls STON2 protein stability in collaboration with the COP9 signalosome complex (CSN). In the nucleus, may link the cytoskeleton with the nuclear envelope, this mechanism seems to be crucial for the control of nuclear polarity, cell movement and, specifically in neurons, nuclear envelope integrity. Participates in the cellular trafficking and may regulate the subcellular location of multipass membrane proteins such as the dopamine transporter SLC6A3, leading to the modulation of dopamine neurotransmission. In the endoplasmic reticulum, plays a role in the quality control of protein folding by increasing clearance of misfolded proteins such as SGCE variants or holding them in an intermediate state for proper refolding. May have a redundant function with TOR1B in non-neural tissues.
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1645
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat